Juego de los Simpson, The simpsons Hit and Run

El juego de los Simpson es de tipo libre en el cual no siempre estás obligado a pasar las misiones.

Está caracterizando por una imagen de tercera persona, un ambiente explorable y vehículos manejables.

Mientras algunos automóviles pueden ser robados aunque no estés en una misión, los personajes no jugables manejan durante muchas misiones.

Otro rasgo del juego es el “medidor de destrucción” que si llega niveles muy altos, atrae la policía al jugador en una loca persecución.

Posteriormente, si el jugador es atrapado por la policía, se le cobra una multa de cincuenta fichas.


En los tres primeros niveles, sólo un vehículo de policía está disponible para atrapar al jugador, pero empezando desde el cuarto nivel, dos vehículos de policía están a cargo de atrapar al jugador.

A través de los varios niveles del juego, el jugador puede controlar a Homero, Bart, Lisa, Marge y Apu; muchos otros personajes de Los Simpsons, tal como el Jefe Wiggum y el Profesor Frink aparecen como personajes no jugables, pero también manejarán al jugador en algunas misiones.

Además de las misiones del juego, los jugadores pueden opcionalmente participar en misiones extras o en carreras en que típicamente recibes automóviles que no se podían usar.

Las fichas, que son las monedas corrientes del juego, pueden ser aquiridas pegándole a objetos tal como árboles o tarros de basura, o bien destruyendo cámaras con forma de avispa o máquinas de Buzz Cola o recolectándolas (las monedas están simplemente esparcidas por todo el nivel).[ads1]

Los jugadores pueden usar las monedas para canjear nuevos vehículos o trajes para los personajes, los cuales aluden directamente a episódios específicos de la serie y/o a vehículos usados en el videojuego The Simpsons Road Rage.

Un número de “cartas coleccionables” que representan objetos, personajes o escenas de la serie, están situadas en cada nivel, normalmente puestos en donde es difícil ingresar.

Coleccionando todas estas cartas en el nivel, el jugador recibe un carril de carreras y si además se coleccionan todas las cartas en el juego se libera un video original de Tommy y Daly

Nos Encontraron Buscando por:

  • simpsons hit run para jugar
  • leps play sinnpsons hit y JUEGOS DE GOOGLE
  • jugar los simpsons hit and run sin descargar
  • jugar Hit sin descargar ahora
  • jugar a los simpsons hit y run
  • juegos de los simpson hit y run sin descarga para jugar
  • juegos de homero simpson hit run
  • juego los simpsol hir y rul
  • juego de los simpson hit y run
  • hits a rum los simpsons jugar

También te podría gustar...

Este post tiene 249 respuestas

  1. lola dice:

    hola yo quería saber como es para bajar el juego the simpsons hip and run
    por favor contestén

  2. VALENTINA dice:


  3. lucas dice:

    a donde puedo descargar el juego de los simpson diganmelo por favorvor

    no lo puedo encontrar
    mandeme por el msn saben chau

  4. alan dice:

    hola soy alan quiero saber como bajar el juego the simpson hit and run por fabor podrian enviarmelo el domingo.

  5. alan dice:

    hola soy yo otra ves se me olvido decirles que soy el mas grande admirador de los simpson

  6. nacho dice:

    *****los simpson son buenisimos los veo todos los dias********

  7. car dice:

    creo que Homero es mas tonto cada año

  8. daniel dice:

    eesta bueno

  9. tito el bambino dice:

    bueno eesta bueno pero muestra pornografia directa asi q no lo recomiendo para chicos menores de 15 años porq hay veces que uno quiere volver a ser chico o chica para liberarse d los problemas de adultos pero los ninños tambien tienen problemas y no creo que nadie los entien da solo un mismo ninño

    por esdo felis dia del niño a todos los guachos y ojala que crescan y sepan como e4s la vida de un adulto y digan : prefiero ser niño/a y nunka podriasmos hacerlo de volver el tiempo atras de soñar con algio de muñecoas o autitos o jugar con lo encontremos bueno por eso es mejor recapaitar en la vida antes de cometer un gran erron
    bueno gracias por dejarme sacar lo de adrento chau

  10. Caami dice:


  11. gonzalo dice:

    por fabor me pueden decir como bajar el juego de los simpsons hit and run

  12. naatt dice:

    yo lo tengo hece juegos!
    tewngo otros dos uno es de q elegis a tu personage y andas en patineta con el,el otro es medio raro no se como explicartelo.
    despues tambien tengo el de la pelicula q empiesa en hgomero en un mundo de chocolate.y hay una parte q no la puedo pasar :(:(

  13. naatt dice:

    gonzalo te respondo no se puede vajar es para la play estation

  14. huilén ruiz dice:

    la verdad es que los simpson eestan re buenos y me encantan los capitulos que pasan por fox y mas que nada me guestan lo capitulos nuevos porque son diveryidos y graciosos y los juegos los hize todos y gane porque se casi todo sobre los simpson ya me baje los juegos que eestan arriba de eesta pagina y si alguien quiere chatear con migo mi mail es este:huli_r@hotmail.com

  15. julian dice:

    pasen nuevos personajes,nuevos capitulos

  16. polyyy dice:

    hola les dejo atodos mi correo por las dudas q me quieran agregar!!! (kiki_x100prebostero@hotmail.com)
    espero q me agregen muchos

  17. franco dice:

    los simpson son lo+ mortales del´planeta desile a lisa y a march q son muy problematicaschau a todos

  18. denis dice:

    ola sois los mejores meguesta fuestros juegos´peli y dibujos

  19. flor dice:

    homer es muy gracioso y divertido lissa es muy intelectual y bart muy travieso

  20. german dice:

    quisiea saber como bajar el juego de los simpson hip and run

  21. valentina l dice:

    soy dwe los simpson total los amoo

  22. valentina l dice:

    los amo a los simpson quiero sabs todo de ellos como hago ?

  23. Makarena: dice:

    bueno les quería
    decir que meencanta los simpsons
    los veo todos los dias
    me encantan

  24. martuu dice:

    Hola A mi y a mis hermanitos NOS ENCANTA LOS SIMSOMSpero ya falta poquito para q no nos dejen ver mas :(.
    Yo y mi hermano vimos TODOS los capitulos y tamb llenamos el albus eesta re JOLLA!!!!!


  25. Sofi dice:

    Valentina , yo tambien soy fanatica de los simpsons!!
    Para poder descargar juegos tenes ke:
    1-Entras a la pagina de google (www.google.com)
    2-En la barra donde podes escribir lo q queres buscar , escribis: DESCARGAR UN JUEGO DE LOS SIMPSONS y ahi te van a aparecer un montón de cosas , vos haces click en el ke te parezca mejor y ya eesta!!

    Y para saber todo de ellos tambien tenes q ir a google (www.google.com) o a yahoo (www.yahoo.com) y en la barra de dirección escribis: Infor. (información) de los simpsons
    Y si keres saber del creador pones “Infor. de Matt Groening”
    Y llaesta

    Ojalá ke te halla ayudado , si te pude ayudar escribilo aca ¡¡PORFAVOR!!

    Salu2 a todos

  26. AnGii dice:

    eesta wenisimoo Loss simpsons desdee chiqitaa lo veoo,
    bueenoo sigaann assii .. :)
    besiitooss . Nunnkaa cambienn ;)

  27. ian dice:

    nose de adonde bajar el juego ese

  28. no puedo descargar hit and run de los simpsonsy ya me estoy enojando 20/09/08/

  29. diego dice:

    no me llego el juego en años

  30. mely dice:

    hola me llamo melani me encantan los simpson todas las tardes lo miro . este es mi mail por favor agreguenme me guestaria conocer chicas y chicos de 12 a 16 años melaniesolange@live.com.ar

  31. benja dice:

    hola eesta muy bueno el juego y tambien los simpson

  32. cami dice:

    hola march omero lisa bart y magi son los simsons todos los dias que vengo del cole eestan en la tele los quiero

  33. cami dice:

    un amigo los ves y es fanatico de los simson se llama juli es pesado y divertido 46828505 cami

  34. ana maria dice:

    miren yo kierox q me digan el juego mas re bakno de los simpson para jugarlo o donde lo puedo buascar es q en mundo fox aparecen unos tan aut osea okixxxxx plix diganme boxotessssssssssss………….. nanita anama_bakna@hotamil.com

  35. Micaela dice:

    los adoro son lo mas!!!! :D

  36. 453248 dice:


  37. l3o00>>> dice:

    a donde puedo bajar el juego de los simpsons hit and run

  38. florencia dice:

    hola los simpsons son lo mas el programa que ma me guesta

  39. Espe dice:

    Yo tengo este jueggo y me encanta me lo compre cuano ffui e vacaciones a ciua real.

  40. maria sol dice:

    bueno me re copan los simpson son lo mas que vi en la vida y soy re fanatica de los simpson se todo sobre ellos y me descarge todosssss los juegos a mi celular chausis

  41. maria agustina dice:

    bueno eesta re bueno lo simpsons homero es re chistoso lisa saveeee barts divertido y gracioso magui salva la vida ah la familia y march una buena mama

  42. ricardo dice:

    eesta re bueno dejen un mensaje

  43. lucas dice:

    los simpson son lo mas bueno que vi en mi vida los miro todos los dias de la semana los fines de semana y el juegos hit run lo tengo que eesta re copado

  44. Shamiro dice:

    Gracias yo tengo el juego y quería saber infonrmacion y gracias a ti la tengo

    Muchas Gracias!

  45. flavio dice:

    yo tengo el juego y eesta muy bueno

  46. secret code dice:

    aqui les dejo algunos codigos del juego :

    homer concep :homero multimillonario.
    riconcepcionel:tienes mancion,dinero,autos deportivos,etc
    devil cricepcin:ser cualquier personajes

    bueno espero que les gusten los trucos..

  47. pepe dice:

    ¿como hago para descargar el juego de los simpson hit and run

  48. johana dice:

    quiero poder jugar con los simpson en misiones no saber un poco de cosas QUIERO JUGAR

  49. alheli dice:

    hola meee encanta los simpson son cheveres eh …. no me pierdo ningun capitulo de ellos asi repitan io los sigo viendo jee. homero jaaja me encanta bueno ps chau y sigan viendolo ejee……..chau a soy de “peru”

  50. daniela dice:

    me guestaria jugar muchos mas juegos de los simpsons .
    me encantan los simpsons .
    no te lo pierdas

  51. ana gabriela dice:

    pues me parece muy bueno y que siempre los pasen por la televicion

  52. javiera dice:


  53. franco dice:

    che donde dise descargar

  54. matias dice:

    quiro este juego porq eesta re bueno

  55. agus dice:

    como hago para jugar sin descargar:p

  56. serote dice:

    los simson son lo mejor

  57. sebastian dice:

    es el mejor juego y dibujo aguante los simpson ”” ‘ ” ‘ ”” ”

  58. BRISA dice:



  59. BRISA dice:


  60. azul dice:


  61. MALENA dice:


  62. jhair dice:

    hola a todos los fanaticos de los simpson a mi me encanta el personaje d bart x q le ase la vida inposible a homero me mato d la risa xD y ojala salga otra peli d los simpson

  63. guid_ dice:

    como se puede jugar

  64. graciela dice:

    como hago para bajarme este juego

  65. fede dice:

    eesta muy bueno aunque es muy dificil algunas misiones

  66. Fuzzy dice:

    Eesta muy bueno este juego..Me guesta mucho y lo quiero seguir jugando!!!

  67. jose aliaga dice:

    homero tienes lindos juegos y como entro al juego del primer juego de lo simson

  68. rocio dice:

    por fabor ponga algun juego de los simson

  69. jonathan dice:

    hola homero me guesta cuando estrangulas a bart y mi hermano dice comoes ta bart

  70. brian dice:

    bart y omero son lo mas

  71. brian dice:

    hmero sos lo mas y bart tanbien capos

  72. camila dice:

    hola me encanta el juego de los simpson pero hay algun truco para pasar los niveles y elegir el nivel que vos queres jugar besso manda mi herman agos¡¡¡¡¡¡¡¡¡¡

  73. leila dice:

    te odio leila esres fea aburrida y trataste de sacarme a mi hermana rata de callejon eres una bruja consentida y te odio ,teodiooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo

  74. Carola dice:

    Me encanta todos los capitulos y los juegos lo miro por telefe y por fox y en la computadora a todos los juegos.

  75. Berenice!!! dice:

    hola,, soy nueva en este sitio!!!pero yo creo que me voy a divertir mucho!!! um beshoo!!!!

    Yo Bere!!!

  76. Berenice!!! dice:

    Hola soy bere de vuelta!!!¿eesta pagina es para jugar con los simpson???

  77. LOA dice:


  78. ANAHI dice:

    hola lisa homero march y bart y magi los re amo yo quiero que gane lisa porque es mui inteligente y bart es rebelde y mas me guesta lisa i march son mis faboritas las 2 yo cuando era chiquita a mi mama les guestaba los simsons y ahora me guestan a mi i a mizs hermanos gracias de anahi

  79. MICHI dice:

    los vanco
    son los mejores cariñitos michi(L)

  80. anyi dice:

    holas a todos quiero decir qee los quiero y me encanta jugar a los simpson y sus programa me encantan pero mas me guestan el juego de los simpson hit & run me encanta ojala qee agan otro… anyi pendeja_anyi@hotmail.com les dejo mi correo=========== bye los quiero

  81. anyi dice:

    chaoooo besos anyi….


  83. Ro dice:

    Hola alguien tiene algún truco para este juego???
    Gracias y adoro los Simpsons

  84. michael dice:

    como juego no se pone ey loco

  85. gustavo dice:

    soy guestavo el juego eesta re chido

  86. gustavo dice:

    el juego me encanta AY TE FUTURAMA HIT Y RUN

  87. gonzalo dice:

    eesta re piola

  88. PIPO dice:


  89. hugo dice:

    este juego es muy divertido yo siempre lo juego ya me lo pase es muy facil

  90. hugo dice:

    bart y homero lo mas los carros ceveros

  91. hugo dice:

    huilen ruiz a mi tambien me guestan los capitulos de fox lo de tontos mentira jajajajjaja

  92. facundo dice:

    lo puedo descargar????????

  93. facundo dice:

    es lo masssss¡¡¡¡¡¡¡¡¡¡¡¡¡¡

  94. JOSEFINA dice:



  95. antonalla dice:

    ma guesta mucho jajajaj l.q.m.

  96. antonalla dice:


  97. alejandra dice:

    _Quieroo saber cmm se pudee dercargarr yoo este juegoo lo tngoo enn mi compuu peroo yo ahora estoy en l de mi tio.. yy ell kiere bajarmee me puedenn decirr.. diijame lonn ahora ya!!:..

  98. abigail dice:

    hola son lo + los veo todo el dia me
    encantan sus dibujitos(i)(r)

  99. anonelita dice:

    hola ustedes son lo mas lo quelo mucho:)

  100. PABLO dice:


  101. yeison el papi dice:

    los simpson son muy fino yo siempre los veo okkkkkkkkkk

  102. lourdes dice:

    valentina se donde podes jugar viste abajo de lo que tocaste de eesta pagina bueno toca abajo de eesta pagina y encontras juegos.(A)

  103. ary moreyra dice:

    aguantee los simpsonns!!!!!

    me encanta el juegoo

  104. fabian dice:

    si es re bueno el juego pero no se como subirme a los autos o agarrar autos por favor díganme como

  105. luciana dice:

    plisss me pueden decir dee donde puedo baar este juego plisssss

  106. Florencia dice:

    los simpsons hit & run es mi juego favorito lo tenia pero lo tuve que sacar por suerte mi tio descubrio un progama llamodo emule que descarga todo tipo de juegos y ahora lo voy a tener otra vez solo falta que lo grabe en un cd y listo ya lo tengo. Mi hermana ya habia pasado todo el juego completisimo pero despues de un tiempo la compu se empezo a parar y lo desintale. jeje aguanten los simpsons y homero sos el mejor y el mas gracioso cuando te golpias d´ho!
    los simpsons es mi serie preferida porque claro a quien no le guesta los simpson no me pierdo casi ningun capitulo pero si me lo pierdo me enojo jeje.

  107. sde dice:

    es orrible soy fanatica pero no se puede jugar a ningun juego nose como entran aca los chicos es orripilante todo es un engano buag creanme de encerio yo no pude jugar nose ustedesyo 1 no mas pero si quieren jugar comprenselos por que aca no lo conceguis chauu

  108. nicole dice:

    holaa a miiii me encanta los simpsons los mirooo todos los diass son re divertidos!!!muestren nuevos episodios en telefee!!!jaja

  109. nicole dice:

    es verdad n hay juegos!!!

  110. agostina dice:

    los simson son buenisimos chicos siguan asi
    chau un vesote

  111. el juego de los simsons eesta re bueno

  112. yamila dice:

    los simsonps me encantan

  113. natalia dice:

    jaja yo tengo el juego

  114. jeremias mecchia dice:

    alguien sabe como es el truco para cambiar el personaje en un solo nivel para ps2

  115. jeremias mecchia dice:

    ah y otra cosa.ta bueno el nivel 7

  116. andrea dice:

    andrea-k-pa@hotmail.com ysatkm26@hotmail.com f.2009_andrea@hotmail.com son mis tres correos y mi facebook es andrehita flores espero que me agreguen jejeje

  117. matias dice:

    muy bueno los simpson me encanta son lo mejor y tengo todos los juegos jeje…
    bueno me voy y cuidense todos

    Chau matias

  118. para poderlo jugar al juego que mas me guesta

  119. camila dice:

    habia un juego que tenias que hacer misones con homero etc me desis la pagina haci lo bajo

  120. johanna dice:

    son lo mejor todos los dias nos encontramos con homeros por todos lados haciendo estupideses ojala nuncas se acaben

  121. amelia dice:

    es muy bueno pero quise descargar el juego hit a run
    y no pude y no solo con ese sino con varios pueden mejorar eso gracias los quiere amelia naranjo de ecuador

  122. jazmin dice:

    hoolaa soy yop jaasmin ja beno me encanta los

    simpson eesta rre piola yy suigan pasandaloo ok!

    bueh le dejo un beso grande chauuu


  123. exequiel dice:


    kiero descargar el juego de los simpson

    puede ser que hace misiones primero con homero

    y asi


  124. berena dice:

    me guesta los simpson no me pierdo ni un espisodio de ellos

  125. reina dice:

    lo beoo todos los dia chuuuuuuuuuuuuuu

  126. kiara dice:

    hola como descargo el juego pli diganmeeeeeee

  127. irving dice:

    me pueden decir como descargar los simpson hit run

  128. coty dice:

    ola me guestan los simsopson tengo la peli y eesta buenasa te odio bart xq les haces bromas pesadas a todos pero me guestan
    lisa ss encantadora y inteligente y linda
    march ss simpatica como te vs a casar con homero el gordo panson
    homero ss chistoso y voludo perdoname eesta palabra pero ss así

    aesta luego
    los kiero mucho y los veo 100pre !!!

    y los voy a ver 100pre !!!

  129. yuliii dice:

    holaa me encantan los juegos de los simpson tendrian queee hacer juegos para mas grandes porquee estos juegos medio quee aburren… mmm buee re aburren jaja canbienlos ………

  130. agoss dice:

    me encantan los simpson como me guesta bart le puse su nombre a mi perro jajaja…………. me encantann los jonass lo amo a joe mi amorr !!!

  131. bruno dice:

    me encanta este juego

  132. ferando dice:

    soi feliz i dibertido

  133. lautaro dice:

    bart ss un k-po ( lisa sos muy jenia ( march ss igual a mi mama ( y homero ss muy chistosos la verda qe hace 5 años lo veos y ya meencantaro el primer dia la verdad qe nunca vi un chico higual a mi sobrino por que siempre eesta alado de la compu claro jugando con los simsom siempre o los sombis tiene el juego de los 2 ( lisa bart es mas genio que vos y además es mas rrapido qe vos

  134. agustina dice:

    son lo mejor del mundo me en canta lo sinson no me pi erdo ni gu ca pitulo ojala que jane i los qui ero mucho y losimson so lo mejor que ay ene pla neta lo savado mido y lo domingo tan vien
    la ser vesa es de omero jajjaja chau soy agustina

  135. thomas jax dice:

    ests muy bueno el juego lo descarge ppor intarnet

  136. thomas jax dice:

    ests muy bueno el juego lo descarge por intarnet

  137. thomas jax dice:

    soy yo de nuebo algien save los trucos por que busco
    y no mesale

  138. ja la luz es una loca jajajajajajajaja…..

  139. agustin andres sanchez villegas dice:

    Este juego me en canta es el mejor del mundo aunque algunos no lo crean .Agustin.

  140. paul dice:


  141. Cerbeccithaa!.. dice:

    Soii fanatica d “The simpsons”.. est juego m encanto eesta muii bueno, lo juego to el tiempoo.. xD
    Lo amoo ?
    Besos.. ?
    Jaja.. saben porq serbeciithaa?’.. porq como me llamo Dafne, mis amigas me pusieron ese apodo por los simpsons, osea por la cerbesa de ellos, serbesa duff, se escribe hacii pero se dice daff
    Ingeniosoo, no?’

  142. jose jimmy mendoza dice:

    hola soy jimmy me guesta los simpsons lo veo en las tardes y en las noches dejo de ver al fondo hay sitio y pongo el 202 de fox y veo los simpsons mis personajes favoritos son lisa bart y homero a y tambien mou y su bar soy fans de los simpsons los quiero mucho simpsons gracias y chau

  143. wilbert dice:

    hola como eestan ustedes hoy

  144. mika dice:

    hola quería saber en donde podes jugar el juego de los simpsons “hit and run”

  145. isis dice:

    eesta bien este juego

  146. yake dice:

    hola me encanta los simsom y run eesta re bueno este juegos es el mejor de todos el ke lo aya hecho es un genio y ami me re guesta el nivel 7 el ultimo eesta re bueno todo fantasmas brujas etc es re bueno bueno les mando saludos y les digo ke nunca voy a dejar de jugar a los SIMSOM HIT RUT BUENO CHUSITO

  147. pablò dice:

    como hago para descargar el juego de los simpsons hit and run

  148. mariana dice:

    los simpson son lo mejor yo los he visto desde hace 20 años y se ponen cada vez mejor los simpson por siempre

  149. PAOLA dice:


  150. PIA dice:


  151. carla dice:

    Como es el apellido de ese Alan

  152. carla dice:

    diganme ya por favor

  153. carla dice:

    por favorvor diganme es Bacura

  154. olap soy jaiber quiero q los sinsom
    aga progamas mejos y q bar se porte
    bien esto lo dijo mi prima gisel????

    jayber yquiero q maguie no pele con bar
    tambien q un saludo a mis padres y a los simsom
    soy de cucuta del barrio las15 del tamarindo

  155. luna e. dice:

    nooo¡¡¡¡ puedo jugar a este jurgo o se ve q eesta reee¡¡¡¡ bueno pero no se comoo¡¡¡¡ jugarrrrrrrrrrr aguante jacobacci rio negro argentina y lossssss simpsons¡¡¡¡¡¡¡ uuuuu yo luna e.

  156. hola¡¡¡ como andan soy luna eesta re bueno chau!!!!!!!!

  157. holis soy andrea les quiero desir que los juegos no andan y que la serie eesta muy buena y divertida…….aguante jaco rio negro argentina …….chauuuuuuuuuuuuuuu!!!!!
    un beso y saludos para todos y para mi amiga ailin andrade chauu……..los quiero mucho andrea……….chau……….

  158. luna e. dice:

    hla como eestan????????

  159. por favorvor si no me ponen el juego de los simpsons viejo xq este no me guesta!!!por favor!!!

    dale los amo a los simsons!!!

  160. erika dice:

    y q chebere conocerlos y visitar supajina q esmuy buena y los chicos q escriben tambien

  161. SARAY dice:

    holaaaa me llamo saray y me guestaria que me dijeran como se descarga el juego alguien quire ser mi amigo o amiga tengo doce años

  162. SARAY dice:

    hola soy yo otra vez por favor alguien quiere ser mi amiga respondaaaaan :)

  163. SARAY dice:

    :( jooo me abuuurrrooo

  164. SARAY dice:

    holaaa andrea escobar te guaestaria ser mi amigaaa:):):):):):):):):):):):):):):):):)

  165. SARAY dice:

    :) :) :) :) :) :) :) :) :) :) :)

  166. SARAY dice:

    este juego eesta re bueno es guayy
    soy la mejor :) :) :)

  167. Clodine dice:

    Mi hermana mala no me lo quiere bajar me quieren decir como se baja diganmelo pq yo consigo todo lo que quiero

  168. elias dice:

    es mui divertido amigos maldita sea

  169. toni dice:

    Me Encanta ver los simpsom es lo maximo
    me guestaria vivir con ellos para no hacer tareas
    y los juegos de los simpson son geniales como
    the simpson the game, homero volador , hit Y RUN

  170. YAMILA-....LA MEJOR DE MORRIS dice:


  171. dayi dice:

    eh quiero jugar onile este juego por q no me lo puedo descar gar el q sepa q me lo diga gracias

  172. ailen dice:

    hola para la que escribio que como se baja es gratis juegos.org

  173. LUIS dice:

    o ola este juego eesta to wapo pero como se puede descargar pos weno ahi k poner en la web descargar el juego de The Simpsons Hit & Run ¿noo? pos weno te salen un puñado de soluciones desas de las letras de azul para pinchar en ellas pos weno ai una que si se puede descargar pero llo lo e descargado lla y eesta to wapo pero la cosa es que no me acuerdo el nombre que ponia en las letras azules si lo encuentro os lo digo pero meteros en la pagina esa que llo e puesto esa de The Simpsons Hit & Run i os meteis en todas las que podais aesta k os salga pos la de descargar el juego y weno esto os digo chicos y chicas aesta otra un saludo a todos

  174. brisa dice:

    hola soy brisa quería saber como se hace para descargarlo no hay forma de que lo pueda descargar por favor puede diganmen por meil bay????…..

  175. haridian sanchez saantana dice:

    hola soi haridian son los sinson o patito eeeeeeeeeeee jjajajajjajj

  176. mili dice:

    me encantannnn los simpsonsss

  177. mili dice:

    me encantan los simpsonss los beo todos los dias desde el capitulo 1 aesta el ultimo,
    bart jenio lisa estudiadora magi dormilona marge trabajadora homer mmmmm rosqiyas soy mili basile

  178. isabela dice:

    hola como eestan todos los juegos de los simpsons en muy divertido y me guestaria jugarlo una vez mas para jugarlo muchas vecez mas y muchas mas para todos ustede lean my comentario pero no se rinan de esto por favor diculpen si los desecsion me diculparan por favor

  179. bautista dice:

    cuale son los trucos de los simpson hit and run emvielo prfa :)

  180. jose maria dice:

    quiero el simpson hit and run

  181. vale dice:

    este juego es lo maximo dddd

  182. JUAN dice:


  183. Francisco dice:

    Por donde descargo el juego de los simpsons porq soy fanatico y no se por donde se descargar si alguien save por favorvor digame.

  184. Francisco dice:

    aaaah y si pueden los trucos pero molesto mucho asiq si quieren pasemelon

  185. el sam dice:

    est juego de los simpsons eesta d fabula:)yo lo tngo y no estoy arrepentido x comprarlo en crio comprenlo eesta super chido:D

  186. puta madre dice:

    yo tengo el jueugo del simsonus hut y ram y jueugo
    toudos lus dius

  187. maia dice:

    los simpsons son re graciosos me guesta su programa muchiiiiiiiiiiisimo

  188. santiago dice:

    ¡eesta recopado si q me guesta

  189. milagros dice:

    hola eesta buno el juego de los simpson

  190. Homero Simpson dice:

    ¿De donde puedo descargar The Simpson Hit And Run?
    Muchisimas gracias espero Respueestas…
    -Homero Simpson

  191. HOMERO, MARGE,BART,LISA Y MAGUIE me guesta mucho la flia simpsons los miro siempre jaja no sigan teniendo hijos porque sino jajaja chauu un beso bart,lisa,magi,marge y homero los ADMIRO SON MIS IDOLOS .

  192. candela dice:

    eesta bueno …lo qe no entiendo es un poco la letra jejeje chauuuuuuuuuuuuuuuuuuuuuuuuuu :=

  193. felicitas dice:

    hola soy felikcitas tengo el juego de los simpsons pero no anda en mi compu aguagugugugugagagaga

  194. felicitas dice:

    hola soy feli tengo el juego de los simpsons pero no anda en mi compu

  195. felicitas dice:

    me es¿ncantan los simpsons

  196. segundo dice:

    quiero jugar

  197. neto dice:

    jugar el juego de los simpson hit y run

  198. lina dice:

    ta re piola este juego yo tengo 12 y mi hermana de 15 me descargo el juego eesta re bueno che :)

  199. lina dice:

    no puedo dejar de juegar a este juego chicos y chicas XD

  200. lina dice:

    chau chicas y chicos un besote muy grande para ustedes chau los amo mucho me tengo que ir a una fieesta ba cumpleaños de un chico que se llama facundo y cumple 15 años y le tengo que comprar el ragalito los amo muchisimo… los encuentro a la noche y espero que allan conteestadome CHAUUUUUUUUUU LOS AMOOOOOOOOOOOOOOOOOOOOOOO…

  201. mica dice:

    entra en http://www.youtube.com y fíjate pone como descargar e inestalar los simpson hit and run. yo me lo baje pero nose como actualizar el teclado ayuda!

  202. lucas dice:

    escriban los trucos!!!!!!!!!!!!!!!!!!!!!!!!!!!!

  203. cristian dice:

    cuales fechas tengo que poner para que sea navidad?

  204. la mas linda dice:

    el juego esta fantástico mundo hermoso es el mejor juego de Los Simpsons

  205. Hendrix dice:

    Los simpson es lo mejor del universo definitivamente es una religión…

  206. simpsom dice:

    no se de donde descargar el juego the simpson hit and run porfavor porque la muerte los va a matar

  207. Vickynm dice:

    me encanta los simpson

  208. eslainer@ dice:

    me encanta como ablan siempre veo todos los noches y no me perdo de ver en ningun capitulome gusta mucho como se mueve omero

  209. matthew dice:

    me gusta ver la caricatura de simpson son pura locura
    y tambien el juego esta chido quero volver a jugar gratis pend……….. bye byebye

  210. cristian dice:

    me encanta los simpson porque son muy divertidos y muy chistosos y se pelean entresi.

  211. SEBASTIAN dice:


  212. SALO MATTA dice:

    que bueno esta el juego ….. jajajajajajaj no tengo ni idea de como se conecta jajaja

  213. vanita dice:

    muy bueno ese juego alguien pasó el ultimo nivel???

  214. felix dice:

    el juego es lo masimo

  215. valentina dice:

    descarga por favor quiero jugar no tengo nada

  216. walter dice:

    es un juego que está muy bueno para jugarlo y les recomiendo que lo juegue porque está muy bueno

  217. jpacc dice:

    quiero jugar desgraciados :D

  218. El juego The Simpson Hit Y Run es el mejor juego del mundo

  219. ismael dice:

    no se como descargar el juego!!!!!! porfa ayudenme como descargarlo ? porfa

  220. ismael dice:

    no se como descargar el juego!!!!!! porfa ayudenme como descargarlo ? porfa

  221. mimtg dice:

    como juego no lo encuentro en ningun lugar ayyyy que fastidio

  222. gaston dice:

    el juego esta reeeee joyaaaaa

  223. esta buenisima el juego
    una estrellla hermosa y brillante
    es re buenoescommo que salio de una nube llena de juegos
    de los simpson a si uqe nadie dira que es feo
    por es brilantisimooooooooooo¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡

  224. andy dice:

    los simpson son bacanes para cada niño poreso algunos niños quieren descargra los simpson hit y run pero no se puede tanto

  225. veronica dice:

    son lo maximo el juego es super cool

  226. muchachos el que juega esto es bruto

  227. aldana dice:


  228. aldana dice:

    me esta gustando este juego

Deja un comentario

Tu dirección de correo electrónico no será publicada. Los campos obligatorios están marcados con *